Wikipedia:Reference desk/Archives/Science/2008 June 19

Science desk
< June 18	<< May | June | Jul >>	June 20 >

Welcome to the Wikipedia Science Reference Desk Archives
The page you are currently viewing is an archive page. While you can leave answers for any questions shown below, please ask new questions on one of the current reference desk pages.

June 19

Less moon near summer solstice

Maybe I'm confused, but I've long had the notion that when the moon is full, as it is today, it rises more or less as the sun sets, and it sets more or less as the sun rises. But now that we are near the summer solstice and the days are extra long (up here near 49 degrees north), it occurred to me this would mean the full moon would be up for fewer hours in the summer and more in the winter. That didn't seem right -- shouldn't the full moon be up for about 12 hours regardless? Or if the Earth's tilt matters, wouldn't it mean the moon, like the sun, was up for longer in the summer? But, in checking the sun and moon rise and set times for today and tonight, it appears that today's full moon does rise more or less as the sun sets, and sets more or less as the sun rises (give or take about 30 minutes). This means that today, where I live, the sun is up for about 16 hours and full moon for only slightly more about 6.5 hours. Somewhere my common sense is confused. Where'd I go wrong? Pfly ([[User talk:Pfly|talk]]) 03:37, 19 June 2008 (UTC)

The moon is up less than 12 hours for the same reason the sun is up more. Geometrically, the earth is now in between the two. The axis is tilted towards the sun, meaning a point north of the equator will have to rotate more than 180 degrees through the sunlit area, and less than 180 degrees through the moonlit areas (at the pole, the sun will be visible during the whole 360 degrees, and the moon not at all). --Stephan Schulz (talk) 07:40, 19 June 2008 (UTC)

There's a lot to be said for blacking out a room and shining a torch at a globe (or any other spherical object if a globe isn't available). You can add the moon to the demonstration by just holding a ping pong ball on the opposite side than the torch - the moon is in roughly the same plane as the sun (IIRC, it's about 5 degs off, but that's significantly less than the Earth's axial tilt, so that's what has the major contribution). --Tango (talk) 12:03, 19 June 2008 (UTC)

Oh I think I get it now. When the Earth is tilted toward the sun it is also tilted away from the moon when the moon is full or near full. I just couldn't picture it correctly in my head yesterday. So, this also means, doesn't it, that near new moon crescents are out for more than 12 hours around the summer solstice? I suppose I can look that up easily enough. Thanks for answering! Pfly (talk) 15:11, 19 June 2008 (UTC)

Yes, quite right. --Anonymous, 17:00 UTC, June 19, 2008.

why only rock salt prism is used instead of glass prism for obtaining infrared spectrum ?

Bold text —Preceding unsigned comment added by 124.253.200.194 (talk) 04:21, 19 June 2008 (UTC)

Because salt is transparent in IR and glas is not!--Stone (talk) 06:52, 19 June 2008 (UTC)

It's generally not true that glass is not transparent in IR; but its dispersion is low. Icek (talk) 21:14, 19 June 2008 (UTC)

Why do dogs wag their tails?

How does it happen that dogs wag their tails, while their ancestors the wolves do not? What might be behind this selective advantage? --Halcatalyst (talk) 14:28, 19 June 2008 (UTC)

I'm just guessing, but do wolf cubs do it? It's not unusual for domesticated animals to show juvenile behaviour in adulthood, see Pedomorphosis. --Tango (talk) 14:36, 19 June 2008 (UTC)

This page] suggests tail wagging is merely to get rid of excess energy. Most scientist agree that dogs wag their tails to express emotion. As a matter of fact, wolves do wag their tails, though not as often. A wolf may wag it's tail submissively when approaching the Alpha male (or female). Also, sometimes wolf cubs wag their tails when they realise dinner is about to be served. = )

I always thought it was to express emotion. A dog wagging tail is usually friendly or excited, probably running after a ball or something, but an aggressive dog might hold its tail high, while a submissive or scared dog might hold its tail low. This is also true for cats, as a happy cat will hold it's tail high in the air, while a submissive cat will lower it. Also in cats a wagging tail is a sign of conflict, like when it can't decide if it wants to go in or out of the house, or if it twitches it from side to side at the end it means it angry. Could it also be for balance? When a dog is running and turns quickly, the front part of its body goes in the direction it wants to go, but it's back continues in the original direction. So the tail might act as a counterweight. Jessica - N10248 (talk) 18:21, 20 June 2008 (UTC)

I heard from the Scientific American magazine that dogs wag their tails when they are nervous.--Apollonius 1236 (talk) 18:29, 20 June 2008 (UTC)

• Just hazarding a guess, could the behavior be due to the fact that the animal was acclimatizing to close interaction with a new species, man, as well as with the now more complicated relationships with others of its species? --Halcatalyst (talk) 20:51, 21 June 2008 (UTC)

Soybean based Biodiesel processing

I have read that using excess catalyst (alkali) in the transesterification process will cause the bonds of methyl esters to break, thus, leaving higher FFA's and free glycerin. Are you aware of any studies, research, white papers, etc. regarding this matter.14:41, 19 June 2008 (UTC)Knowwhat4 (talk)

The reaction is

(soybeancarboxylic-acid)₃glyceride + 3 methanol >>> 3 soybeancarboxylic-acid methyl ester + gylcerin

The reaction you are thinking of is (soybeancarboxylic-acid)₃glyceride + 3 water >>> 3 soybeancarboxylic-acid (FFA) + gylcerin

trans-esterification means swapping the R-OH groups (alcohols) see - Transesterification

To obtain FFA (free fatty acid) you need to do hydrolysis

Adding more catalyst may speed up the reaction..87.102.86.73 (talk) 17:04, 19 June 2008 (UTC)

Hydroxide is the catalyst for the transesterification, but it's also the reactant for the saponification (hydrolysis). So you need "enough" catalyst to make the reaction you want happen efficiently, but not so much that the alternative reaction happens substantially. DMacks (talk) 18:39, 19 June 2008 (UTC)

Just realised I didn't properly answer - the answer is 'YES' adding alkali will cause production of the fatty acid salt - which can be converted to the fatty acid by acidification - it's a slightly different reaction, and does require addition of the alkali in non-catalytic amounts.

eg (soybeancarboxylic-acid)₃glyceride + 3 sodium hydroxide >>> 3 sodium soybeancarboxylate + gylcerin

Link to saponification or just web search for the same term.87.102.86.73 (talk) 21:36, 19 June 2008 (UTC)

Hemimetabolism vs Exopterygota

What are the diffrence between the two? —Preceding unsigned comment added by 192.115.235.2 (talk) 17:00, 19 June 2008 (UTC)

By reading the articles, I can see that one is a group of animals and one is a mechanism by which certain animals mature. Again, by reading the articles, the group appears to be a group of animals which use that mechanism (at least some of them, others may use a similar but different mechanism, the articles weren't entirely clear about that). --Tango (talk) 17:40, 19 June 2008 (UTC)

Thanks, The question is if it's the same group? I don't think other insects use the same mechanism since if they do they would be added to the same group. So does it mean the insect group and the mechanism are the same? —Preceding unsigned comment added by 192.115.235.2 (talk) 18:03, 19 June 2008 (UTC)

Hemimetabolism discusses insects both amphibious and terrestrial. The Odonata, for instance, are amphibious. The taxon that you single out, Exopterygota, are mainly terrestrial, but the Exopterygotan stoneflies are amphibious. HTH. --11:01, 20 June 2008 (UTC)

Gene promoter prediction

From this online gene promoter prediction tool, I get the following possible promoter sequences for GREM1 gene sequence (1000 bp before transcription start site and 1000 bp after). The bold letter is what it claims might be the transcription start site. Is it not possible that they are both promoters with only one (the later) containing the transcription start site?

Promoter predictions for 1 eukaryotic sequence with score cutoff 0.80 (transcription start shown in larger font):

Promoter predictions for seq0 :

 Start   End    Score                Promoter Sequence
 412   462    0.83    AGCCCGCCAGGTTAACGGGGGCGCCGGGGTCAGCGCCCTCGAAGTTGGGG
 961  1011    0.99    TGCCGCCGGCATTTAAACGGGAGACGGCGCGATGCCTGGCACTCGGTGCG

--145.29.22.90 (talk) 17:10, 19 June 2008 (UTC)

Reproduced embossed seals in diploma plaques

There are services that reproduce diplomas and certificates as metal plaques that can be hung on walls. Embossed seals in the original documents are somehow reproduced like stamped marks. Are the reproduced embossed seals manually recreated or are they mechanically converted to printed marks? If the latter, how is it done? --71.162.249.253 (talk) 17:58, 19 June 2008 (UTC)

Not sure, but the xv Unix graphics program has an option to convert a pic into what looks like an embossed image. StuRat (talk) 22:34, 19 June 2008 (UTC)

The program feature you mentioned achieves something different from what I was talking about. If you search for "diploma plaque" using your favorite image search engine, you'll see examples of the kind of plaques I was referring to. In those plaques, the embossed seals of the institutions issuing the original document are replaced by recreated (re-drawn?) facsimiles. When you scan a document that has an embossed mark, the depth of the impression does not translate very well into lines, although if the light source is directional, the edges in the embossed marks can be discerned based on the shadows. It doesn't look like a straightforward process to go from a scanned embossed mark with shadows to the final recreated rendering. --71.162.249.253 (talk) 09:08, 20 June 2008 (UTC)

I note [1] which simply asks for a copy not an original. My guess is that provided they can see the embossing, it's easy to recreate. As far as I'm aware, the embossing is usually simple with one thickness. So provided you can see the mark left by the embossing, you just have to create a depth for the mark and it looks fine. I would guess they also have many common documents & marks already available in their systems Nil Einne (talk) 11:25, 20 June 2008 (UTC)

sentient dinosaurs

What is the liklihood that dinosaurs (and/or other such critters) would have evolved to the point of sentience if they had not gone extinct? Would there be a parallel evolution with mammals or is more likey that one species would have out-competed the other? If we remove the mammal factor, would they have developed sentience? —Preceding unsigned comment added by 69.77.185.91 (talk) 18:36, 19 June 2008 (UTC)

Dinosaurs were on top of the food chain for 160 million years, are still wildly plentiful today in the form of birds, and have never evolved enough intelligence to leave any manhole covers or other long-lasting artifacts around for us to find, so presumably they did fine with their "walnut-sized" brains. Speaking as the owner and amused observer of a flock of small dinosaurs, they've got a long way to go. --Sean 18:58, 19 June 2008 (UTC)

Some scientists speculate that the most intelligent dinosaurs (such as velociraptor and troodon) would have evolved into a bipedal "human like" dinosaur known as the dinosauroid. An artist and scientist Dale Russell has actually produced a sculpture of the hypothetical dinosouroid you can learn more about the dinosauroid and see the dinosauroid sculpture at this entry in the internet encyclopedia of science more information about dinosauroid.--Apollonius 1236 (talk) 18:45, 20 June 2008 (UTC)

Had they not gone extinct could they develop sentience? Well some dinosaurs did evolve into modern day birds which are alive and well today, and they did not develop sentience. Those were theropod dinosaurs. The others went extinct like Sauropods. There seems to be a positive correlation between intelligence and animals capable of eating meat. The most intelligent animals, Humans and other primates, pigs, dolphins, octopi, etc all can eat meat. The proteins in meat apparently stimulated brain growth. So unless Sauropods and Cerapods could have evolved into meat eating animals, we can probably rule them out. Theropod dinosaurs did eat meat, and they also evolved into birds. Life span is also a factor in intelligence. An animal must live long enough to learn and teach things. That's why wisdom is associated with age. Octopi are smart, but they don't live very long. Just a few weeks maybe. If they could live to 100 years, maybe they could have evolved sentience. Giving time to learn and teach is critical. Feral children are a good example of humans that are not taught modern education, and they are almost indistinguishable from wild animals. So I guess the answer is probably no, because theropods would have been the most likely to develop sentience since they eat meat, but they evolved into birds which are not sentient. ScienceApe (talk) 19:25, 19 June 2008 (UTC)

A little pedantic, I know, but the preferred plural is "octopuses" (see Octopus#Terminology). ;) --Tango (talk) 21:12, 19 June 2008 (UTC)

Octopuses live for much longer than a few weeks. Depending on species, they may live for between 6 months and 5 years. I am also fascinated with your assertion that if octopuses "could live to 100 years, maybe they could have evolved sentience." Why would you think that? Even assuming an octopus would "learn" something in 100 years of swimming about dodging calamari fisherman that it didn't "learn" after 5 years, how would that promote the evolution of sentience? Moreover by almost all definitions of the word, Feral children are just a sentient as any educated child, since one doesn't get taught to be sentient. I think you may also be confusing Sentience with Sapience. Rockpocket 02:31, 20 June 2008 (UTC)

Most species don't live very long at all. A few months is still a pathetic lifespan. So is 5 years at most. I think lifespan is very important to learning and teaching. We spend a huge amount of our lives merely learning. At best, you'll be 21 or 22 before you are fully educated with grade school, highschool, and 4 years of college, and some continue their education past that. We associate wisdom with age because with age, you are given lots of time to learn new and useful things. There are a lot of things that we can no longer do when we get old, but learning is not one of them. You can ALWAYS learn something new. Learning and teaching is essential to technological growth.

Now if we have an animal that shows great problem solving intelligence, and has the potential to learn, then this animal has great potential to be technologically advanced. However, if it only lives to 5 years of age at the most, this would inhibit technological growth, because the animals will not have the time to learn and teach knowledge.

Sure, I might be using the word "sentience" wrong. I'm mostly just talking about the potential for octopi to be as technologically advanced as.... well us. I could be wrong of course. This is all just conjecture and speculation, but I would love to test my hypothesis. Now if we could identify the most intelligent octopus species, and genetically engineer them to live to lifespans of over 100 years, I would love to see what they are capable of. ScienceApe (talk) 18:29, 20 June 2008 (UTC)

Who says that all birds aren't sentient? As our sentience page points out, the definition of sentience is rather contested. Under some definitions birds would be sentient, even if they don't leave behind "manhole covers" (lest we forget, humans left behind zero vestiges of civilization as well for most of our history). As for whether they would—I don't think it's unlikely to assume that many dinosaurs did have a lot more cognitive power than others, and some probably could be "self-aware" in a rudimentary sense. If you mean, "as smart as humans," well, probably not, but then again we don't know all that much about the evolutionary history of human intelligence, either, and we do appear rather exceptional. (You could also ask whether the dinosaurs would ever develop a sense of smell as good as a dog or a wolf, or vocalizations on par with a Grey parrot, or sight on par with a hawk—that is, pick another trait that a highly evolved species is extremely exceptional in regards to. Note that when you make it something less tangible and wrapped up with our essential "humanity", it becomes a lot easier to conceive of it happening. Note the special accord we give our own traits, and the special credit we give ourselves for having developed them!) --98.217.8.46 (talk) 21:07, 19 June 2008 (UTC)

In support of your last comment - we frequently point out how intelligent humans are for being the only animal to do XYZ, only to discover lots of other animals doing it (toolmaking, for example). --Tango (talk) 21:12, 19 June 2008 (UTC)

People tend to define "sentience" as the same thing as anthropomorphism. E.g., imagining dinosaurs would start walking erect and building minivans. The idea that any other animal would evolve toward becoming human-like is rooted in the outmoded belief that humans are the pinnacle of evolution, and evolution naturally progresses toward a human-like state. This is just as silly as a self-aware bird thinking that, given a few million years more of evolution, humans may finally achieve birdience, grow feathered wings, and start building complex mud nests on the sides of rock walls. Anyway, it's likely that relative intelligence in dinosaurs would have increased over time...because it has. The brains of many modern birds are equal to or larger than the most intelligent non-avian dinosaurs. Whether or not this means they are s mainly marter is probably unknowable, but it's likely that things like the crow and the gray parrot are the smartest dinosaurs ever. Dinoguy2 (talk) 23:34, 19 June 2008 (UTC)

I live in a region that is very well populated with crows, specifically American Crows and Northwestern Crows, and I would say they are sentient. Of course there is no precise definition of "sentient", nor an easy way to measure it. And my statement is just opinion and "original research" -- although the crow page has some info on their intelligence and external links to much more. But really, spend some time watching these "pests" and you start to realize their behaviors are amazingly complex and constantly changing to adapt to circumstances. They don't only say "caw caw!", but have a surprisingly rich and subtle .. vocabulary. They are amazingly social, at least around here. They know the identity of other crows -- kin, kith, alien, etc -- so it seems odd to me that they wouldn't have some kind of sense of self. And unlike many other birds, they are keenly aware of their surroundings -- of you, if you happen to be nearby. I'm skeptical that they have symbolic thought like we do, but we're talking sentience here. There's your sentience dinosaur, if you ask me. And crows aren't even the smartest of birds, if I'm not mistaken. Pfly (talk) 06:26, 20 June 2008 (UTC)

Carl Sagan tackled this very idea in his book The Dragons of Eden. — The Hand That Feeds You:^Bite 13:09, 21 June 2008 (UTC)

A tangent: if a hypothetical species of sentient dinosaur had evolved in the Mesozoic (see Robert J. Sawyer's "Forever" and Isaac Asimov's "Day of the Hunters"), what technological level would they have had to reach to make it likely for us to find their remains? How would this be affected if their place and time was in an incongruity in the fossil record?

(I'm guessing that significant extraction of fossil fuels would be detectable today, since most of those are Mesozoic or earlier; I doubt anything would be left of, say, a Mississippian-level civilization except the bones of its builders, and considering how few fossil species we've found... Not that I think it did happen, I hasten to add. For that matter, I don't think the late Mesozoic ecology, with an unusually large portion of the energy locked up in the huge animals, would be very conducive to a smart species evolving reasoning capacity or a reasoning species building a civilization. Intelligence probably wasn't adaptive except at the troodontid's niche; otherwise it probably would have evolved elsewhere. On modern Earth, elephants, crows/ravens, the African grey parrot, dolphins, and primates have independently evolved high levels of intelligence; if it would have helped a ceratopsian or sauropod's survival to be smart, it would probably have become so.) Vultur (talk) 04:59, 23 June 2008 (UTC)

Bird population control

Listening to the radio the other day, I heard a story about trying to control the cormorant population around Lake Champlain. It seems that biologists are coating the eggs with vegetable oil so that they won't hatch. I'm not really sure how that works but whatever. What occurred to me first was, why don't they just take the eggs away or something easier than coating them with oil? Dismas|^(talk) 18:40, 19 June 2008 (UTC)

I guess it would either upset the parents in an undesirable way, or the parents would just lay a new egg to replace it. --Tango (talk) 18:55, 19 June 2008 (UTC)

This has been done for years on the Sister Islands at the north end of the lake at the northwest corner of Grand Isle. It's mostly done because the sport fishermen on the lake object to the cormorants competing with them for the game fish. And the reason you don't take the eggs away is that birds will lay more eggs to replace missing eggs, but will waste time (several weeks) brooding infertile eggs.

Atlant (talk) 19:18, 19 June 2008 (UTC)

Egg shells are porous, and clogging the pores with oil kills the embryo by depriving it of oxygen. --Sean 19:01, 19 June 2008 (UTC)

I wasn't aware that they'd lay another one if the first disappeared. Thanks for the answers! Dismas|^(talk) 19:06, 19 June 2008 (UTC)

measuring airflow

I have installed one of those wind-turbine roof vents (aka "whirly-bird"). Fans used in "whole house fans" would obviously move much more air but I am curious as to how one would go about measuring the flow of air as it leaves one's attic. OK. Let's be honest: I am really wondering if there is enough airflow via the whirlybird vent to run venting from the whirlybird through the ceiling to move the hotter indoor air (I am thinking of a "passive" approach to the whole house fan idea). —Preceding unsigned comment added by 69.77.185.91 (talk) 18:44, 19 June 2008 (UTC)

An airflow meter typically uses what looks like a computer fan but is, in fact, a free-spinning impeller with some sort of tachometer attached to it. You can actually do a fairly good simulation with a real computer fan and a stroboscope or by modifying the fan to output tach pulses but not run the brushless DC electric motor. Calibration is pretty arbitrary, though. I used just such a jury rig when I was considering abandoning a return air duct in my house; there, I was concerned with the air flow ratio between four different return air registers.

Another style of airflow meter uses a self-heating thermistor, but I've only seen these in fixed installations for go/no go testing of airflow. The fuel injection system in your car may use a similar arrangement as the mass flow sensor for incoming air.

Atlant (talk) 19:05, 19 June 2008 (UTC)

Keep in mind that the airflow will dramatically change when you attach a duct to the whirlybird, now you have pressure drop through the duct system. If you have enough airflow to spin the whirly, maybe you should be looking at wide-open windows with a deflector, like a casement window. You will get far more air volume that way. Franamax (talk) 23:37, 19 June 2008 (UTC)

Getting Kicked in the Testicles and its effects on the digestive system

What if somebody kicked me in the testicles and how would it affect my digestive system? Ericthebrainiac (talk) 19:23, 19 June 2008 (UTC)

One is not related to the other. However, I recommend against original research. — Lomn 19:34, 19 June 2008 (UTC)

He's probably referring to the nauseous feeling associated with being kicked in the testicles. ScienceApe (talk) 19:37, 19 June 2008 (UTC)

Being kicked in the testicles does not affect your digestive system. As for the nauseous feeling you may feel, that's one of the body's many ways of dealing with pain. It's very common to feel sick during extreme pain, such as when kicked in the testicles. Regards, CycloneNimrod ^talk?_contribs? 20:24, 19 June 2008 (UTC)

The foot delivered an unending holocaust of pain as it rocketed into Zamboni’s crotch. -- Toytoy (talk) 02:47, 20 June 2008 (UTC)

Not true. The nerve endings in the testicles are connected to your innards. I don't remember what organ exactly. Anyway, it can have a negative effect - feeling pain somewhere in your belly. I felt A LOT of pain somewhere in my belly when I got hit in the testicles. My doctor recomended strengthening abdominal muscles and regularizing eating habits to me. Ask your doctor what he thinks you should do. I still get a weird feeling in the belly sometimes.

When you're kicked in the testicles, you feel pain in the belly, but that's a result of your brain misinterpreting the source of the pain: the digestive system isn't actually involved. The innervation of the testicles is by T9/T10-L1/L2. The innervation of the abdominal viscera (small intestine, colon, rectum) is also T9-L2. Your brain perceives the sudden increase in nerve impulses from the kicked testicles and misattributes it to the digestive tract. (There's a similar explanation for why gallbladder pain is often felt in the right shoulder). - Nunh-huh 08:27, 22 June 2008 (UTC)

I wasn't clear enough. Not only did I experience pain in the belly, but eating could trigger the pain as could going to the restroom. There were also irregularities/difficulties with defecation. The conclusion here is that if these symptoms were experienced by someone kicked in the testicles, they are probably not a product of the imagination, but very real. Hope this is helpful.

I think the bottom line is that it is extremely unlikely that anyone has done any real research on how a swift one to the nads may effect metabolism, bowel motility, or anything else along those lines. For one thing, I don't think you'd be able to find an ethics board in the world that would clear this research. Moreover, good luck finding volunteers. --Shaggorama (talk) 15:13, 23 June 2008 (UTC)

evolution/natural selection and complexity

I realize that evolution isn't a process that will necessarily produce 'better' or more intelligent organisms over time, but is it true that evolution always tends to produce increasingly complex organisms over time? Are there counter-examples? ike9898 (talk) 21:11, 19 June 2008 (UTC)

When life first evolved, it started with very simple organisms, and more complex ones occurred later, but the simple ones are still around, and I don't think recent (as in, the last 100 million years, or so) evolution has made organisms any more complicated. I would say that evolution doesn't favour simple or complex organisms, and the percieved change from one to the other is just because life started out as very simple. --Tango (talk) 21:17, 19 June 2008 (UTC)

Well, do organisms ever become less complex? ike9898 (talk) 21:44, 19 June 2008 (UTC)

Yes. Viruses are one example. Another might be flightless birds, which have lost the (complex) ability to fly. StuRat (talk) 22:21, 19 June 2008 (UTC)

I have a book within reach by Professor John Tyler Bonner. On the back-flap it mentions another of his books, The Evolution Of Complexity By Means Of Natural Selection. So I'd have a look at that. Parasites are another example of the evolution of less complexity. The ancestors of wales used to have legs and walk about on land, they cannot do that any more. (I wonder if being less-intelligent-than-a-human is beneficial to some animals, so they have evolved to never become more intelligent?) 80.0.101.122 (talk) 23:26, 19 June 2008 (UTC)

Yes. In humans, it can take up to 20% of the daily calories to run the brain due to it's size. Our brains developed in such a way that they were beneficial (having bigger brains allowed us to get more food). However, in some animals, a bigger brain just wouldn't really be feasible. Sure, if the brain got big enough, I guess it could help any animal; but the brain has to support the animal through each successive step. Ζρς ι'β' ^¡hábleme! 00:52, 20 June 2008 (UTC)

There is another reason to limit intelligence. Intelligence, and complexity in general, makes a system more likely to fail. In the case of intelligence, look at the portion of people who have mental disorders. I'd suspect that the portion is much lower in organisms with simpler brains, as a simpler system has fewer ways it can fail. So, unless the organism can benefit from intelligence in excess of this risk and the energy cost, it's better to have a lower intelligence. StuRat (talk) 01:11, 20 June 2008 (UTC)

Let's face it: we as a species are not going to survive for hundreds of millions of years like the dinosaurs did. Sooner or later someone's going to set off a doomsday device and that will be it. It's great that we didn't do it in the first 60 years that we've been able to, but we've still got a hundred million years to go. Basically our *only* chance to survive is to become less intelligent. Vonnegut's wonderful Galapagos lays out an amusing way for it to happen, a happy alternative to our fate shown in Cat's Cradle. --Sean 03:53, 20 June 2008 (UTC)

I can't think of a single example of how "intelligent" genes in humans could be selected against. Zain Ebrahim (talk) 11:28, 20 June 2008 (UTC)

It's more likely to happen through culture than genetics - just stop educating people, and they'll be less intelligent. --Tango (talk) 12:04, 20 June 2008 (UTC)

Good point. Zain Ebrahim (talk) 12:19, 20 June 2008 (UTC)

If high intelligence generally speaking makes a species powerful enough to eventually destroy its own environment, then high intelligence will be selected against. --Sean 13:33, 20 June 2008 (UTC)

Or even more mundanely, all being selected against means having less a chance to reproduce. In our current society, high intelligence is often selected against in that sense—the more education one has, the less children one has, typically. --98.217.8.46 (talk) 13:59, 20 June 2008 (UTC)

That won't work because harming the environment hurts everyone's chances of reproduction equally (actually it's more likely to affect the poor), not only the most intelligent. However, stupid people, especially men, who have random sex with no birth control, are likely to have more survivng offspring than those who are smart and responsible. StuRat (talk) 13:59, 20 June 2008 (UTC)

Why do you say "mundanely"? The positive correlation between level of education and intelligence coupled with the typically fewer children that educated people have seems like a good source of anti-selection of intelligence. I suppose it doesn't make much of an impact because of other factors (such as disease and poverty) which select against the unintelligent genes. Zain Ebrahim (talk) 14:42, 20 June 2008 (UTC)

Why assume that? The situation in which the least educated have the most surviving children, and education is pretty available to smart people no matter who their parents were, has only been around in the countries where it exists for a few generations. Why assume it won't have much of an impact? 79.66.20.219 (talk) 15:23, 20 June 2008 (UTC)

Wowow. So many issues here! Passing the "(some) birds lost flight" and "whales lost walk" making them less complex which is just nonsense in terms of evolution. Totobagins, any doomsday caused by an intelligent species and that would wipe out the said species cannot be included in a pattern of evolution. Firstly, because in our case, it is a cultural creation (no one ever developed into a doomsday device but we made it with our dexterous little fingers, thus an intelligent species might be culturally inclined never to develop such weapons - I said might but I agree that any intelligent species would tend to develop increasingly destructive devices). Secondly, because if there was such a device that could wipe out a whole species with no further offspring, then it plays no role in their evolution since it simply stops it. The only way you could argue your point would be if you could have a look, say, at all the intelligent species of a galaxy and ascertain that every time they reach a certain threshold of 'intelligence' they destroy themselves (and even then one counter-example would bring it all down). It could also be argued that in our current state of mind no actual big nuclear war would wipe out the human species. One would really have to want to kill everybody to succeed (some gruesome scenario I can think of would involve some religious doomsday/redemption/salvation type scenario where the button pusher would positively think that human salvation would be achieved through the death of humanity ... hum). So if there are survivors it could be argued that they'll just carry on (somehow also be 'fitter') and who knows, one day learn the lesson. One good counter example would be Ridley Walker where a big-badaboom wipes out culture and the back-to-stone-age-humanity's only obsession is to recreate the conditions of the emergence of their culture a.k.a. The Bomb, in an inescapable cycle of self destruction. But then this is just a - good - novel.

An other idea I would have to take issue with is that: In our current society, high intelligence is often selected against in that sense—the more education one has, the less children one has, typically. Less children is correlated with wealth and education. Education has some links to genetic potential of intelligence but is in no way directly correlated with it. You can take a poor kid from a big family and he will have the same potential for intelligence as a rich kid from a small family. Thats because we're all Homo sapiens (woohoo), and as far as I'm aware, you cannot significantly link the big variations of genetic potentials for intelligence inside the species to any (racial, social, etc) group of humans (and I'd love to be proved wrong). So I don't see how high wealth and level of education could have a positive influence on genetic evolution of intelligence potential. ACTUALLY, I think I would be ready to argue the opposite. First by saying (again) that someones culture doesn't make him and his offspring in any way more genetically intelligent. Then by saying that if a poor family who lives in harsh conditions has a lot of children and a lot of them die, that's a pretty good evolution stress element that would push towards better cognitive adaptation and capabilities. In short, whether a rich, educated and thus protected lineage (i.e. look at European nobility) is shielded from environmental pressure and thus can drift all it can, the genetic tree of a poor family will be pressured towards better brain fitness. This will give some chance to poor individuals to grow successful and shield their family in turn from outside pressure, etc, in a cycle that would put the pressured poor humans as the positive evolutionary reserve of the species. Ok this is really total speculation since it assumes some sort of stability of a the poor-rich system that could be analyzed over an evolutionary significant portion of time. Still I wanted to debunk some of the ideas that have been put forward in this thread because they just seemed absurd. The biggest one being a direct link between someone's education and the genetic intelligence of his offspring.

Like Sturat said, viruses are a great example of an organism that lost its ability to reproduce by itself and became dependent on a host to survive. How this is the opposite of a 'complexification' process I'm no quite sure. The way I see it, if an organism, over many generations, somehow manages to give more autonomy to its cells so that one day they would turn back to being a colony of cells as opposed to one organism, that would be an example of 'decomplexification'. I guess we haven't yet defined what a process that makes an organism more complex would be, even less what its opposite could be. John-jack 200.127.59.151 (talk) 16:12, 20 June 2008 (UTC)

(Remove indent) 98 made a theoretical point which I still think is valid - and I know that this would be impossible to test empirically because there are many many other factors which select each way. Assume the following:

• Genes control intelligence to an extent. You took exception to this above on the basis that we're all homo sapiens and therefore any differences in intelligence are attributable to the non-genetic components of our phenotype. I disagree. That a small part of the difference is due to genetic differences is unfalsifiable, AFAIK.
• Differences in intelligence can explain some of the differences in level of education.
• Differences in level of education can explain some of the differences in number of offspring.

None of these are unreasonable IMHO. So there's a direct link between "intelligent genes" and reproduction.

I don't think anyone is suggesting that certain racial or social groups inherently have more "intelligent genes" simply because there are many other factors which select for and against intelligence/education/wealth/etc - this is just one of those factors and its effect would be impossible to gauge in practice. But none of this invalidates the theoretical point. Zain Ebrahim (talk) 20:54, 20 June 2008 (UTC)

There is a recent article about an example of the evolution of complexity being observed here: http://www.newscientist.com/channel/life/dn14094-bacteria-make-major-evolutionary-shift-in-the-lab.html There is also a link to 24 myths about evolution, one of which is increasing complexity. 80.0.110.56 (talk) 14:55, 22 June 2008 (UTC)

Does the nature need the primitive organisms to exist?

For example, any bacteriums? Or, does the nature need only developed creatures? For example, the animals? Must be all bacteriums in the length of time any developed creatures? Have the bacteriums in nature for them any works to do? Can any developed creatures work the same job? Are the bacteriums an evidence of evolutions, because these are simple creatures? Are their job simple for nature? For example. Who can clean the nature (waters etc), if there are not any bacteriums? Have a boing jet only complex components, have not it any simple screws? Are any screws for a boing jet trivial?--78.177.173.0 (talk) 01:24, 20 June 2008 (UTC)

That's a lot of questions rolled into one, but I think the main thing you're driving at is covered in the description of an ecosystem. Ecosystems are complicated things, because organisms evolve to fill niches, and as they evolve they create more niches. Certainly modern ecosystems need microorganisms for various purposes, and if you suddenly killed all the bacteria you wouldn't find life of other forms surviving for much longer, either - even humans need certain microorganisms in our digestive systems. However, I suspect that it would be possible to genetically engineer an ecosystem composed only of macroorganisms, but it would probably be terribly inefficient given the myriad jobs microorganism do efficiently.

As to whether the existence of bacteria is evidence for evolution, not really - a creationist or intelligent designist could equally argue that the creator understood the need for microorganisms in an ecosystem and designed accordingly. Confusing Manifestation(Say hi!) 02:48, 20 June 2008 (UTC)

To stress the point: Humans are mostly movable containers for colonies of microorganism, and are entirely dependent on these for survival. We are reasonably efficient as containers, too - about 90% of the cells inside a human are microorganisms. Without symbiotic bacteria, you will get very little nutrition from food, for example. See Human flora. --Stephan Schulz (talk) 12:36, 20 June 2008 (UTC)

Don't forget the bacteria which are vital to the nitrogen cycle, without them we would be pretty screwed too. --Mark PEA (talk) 16:39, 20 June 2008 (UTC)

Rats and mice kept free from microorganisms live healthy lives, but they have to be kept in quarantine, so a typical human couldn't keep himself bateria-free in the usual environment. A human would not get too little nutrition from food, as the human digestive enzymes suffice, and most bacteria live in the colon anyway, were hardly any nutrients are taken up by the body (butyric acid is partly used by the cells in the lining of the colon IIRC). Regarding the vitamins, AFAIK it's mainly vitamin K that is relevant in this context, but vitamin K is also contained in certain common foods. Changing the proportions of species in the human gut by e.g. antibiotics may lead to problems, but judging from mouse and rat experiments, a human could live healthy without any bacteria inside him. Icek (talk) 21:48, 20 June 2008 (UTC)

Why say the evolutionists that the microorganisms are any primitiv creatures, if these have a place in nature, in an ecosystem? For example: We have a spoon, a cutlery that these are simple instruments. We need these to eat, not a computer. Must be all things too complex, so that man says these are perfect? Are the microorganisms perfect or primitiv?--78.177.173.0 (talk) 14:19, 21 June 2008 (UTC)

Nothing is perfect. Some microorganisms could be described as 'primitive' if they appear little changed over millions of years, but they have not changed much because they are well suited for their niche and their niche has not changed. I don't tend to encounter the word 'primitive' used by biologists, 'simple' is more common in my experience to describe an organism which is not complicated. So, your question doesn't make a lot of sense. 79.66.20.219 (talk) 20:40, 21 June 2008 (UTC)

In science, "primitive" does not necessarily have negative connotations. Primitive characteristics are those observed in earlier species in a lineage, while "derived" characteristics appear in newer ones. --Stephan Schulz (talk) 09:08, 22 June 2008 (UTC)

Most organisms on Earth are simple ones (bacteria, etc.); most animals are invertebrates. Humans are the 'top of the heap' food chain wise, but the top of the trophic pyramid is supported by the base! Most of our ozxygen is made by microscopic phytoplankton; tiny arthropods, worms, etc. recycle nutrients into the soil. Vultur (talk) 05:08, 23 June 2008 (UTC)

Then, how can the simple bacteria know its job in the too much complex ecosystem, if a bacteria have any simple (brain or intelligence center, or etc.)? How coordinate the nature all these, if these do not know, how all whole ecosystem must work? How can any simple microorganisms works harmonic with nature without knowledge of physical laws and other all knowledge, that it needs for an ecosystem. For example, the humans with a developed brain, do not know good, how the whole ecosystem works. And therefore the mankind annihilate the earth. But any simple organisms support it, live harmonic with it. How can any bacteria etc. take into consideration the all knowledge, so that it works harmonic with nature?--78.177.173.0 (talk) 18:30, 23 June 2008 (UTC)

How best to refute a common myth about central heating?

I often see on forums people saying that it is cheaper to heat a house all day rather than heat it from cold just before you return from work. Of course, this is incorrect and the later option is the correct one.

An example of typical resoning behind the heat-all-day myth is this excerpt: ""Run it constantly....Think about it, it take much more energy to heat a kettle of cold watter, and alot less if its already warm warm, topping it up....Same goes for heating, heating a cold house takes hours, maintaining it at a constat level takes a lot less energy. " From http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html

What is the best and most succinct way to refute this mistaken notion? I mean verbally rather than inviting the person to observe an experiment etc, and bearing in mind that the person is unlikely to understand technicalities like the Laws Of Thermodynamics. Thanks. 80.0.101.122 (talk) 23:36, 19 June 2008 (UTC)

The way I always thought of it is: turn the heat down, and wait 'til the heater comes on again - all that heat has to be replaced when you come home, so you haven't saved anything yet. But once the heat comes on again, now you're saving money, because you're keeping the house "less warm", so you're spending less on heating up the entire planet, i.e. less heat is escaping from your house. Same works for air conditioning, when you turn the temp up, you don't save anything until the next time it comes on, then you're getting a benefit. Franamax (talk) 23:44, 19 June 2008 (UTC)

Also, you can explain thermodynamics in terms of water - the higher the heat the faster it flows downward to the cold part. That way you don't have to describe how Euler's number works. Franamax (talk) 23:47, 19 June 2008 (UTC)

Would anyone like to try writing a brief refutation of the myth, that could be used in forums etc please? 80.0.101.122 (talk) 23:54, 19 June 2008 (UTC)

How are you so sure that "the later option is the correct one" if you have no proof of your own. The cost to run the appliance depends on many factors such as outdoor temperature, current indoor temperature, expected indoor temperature, humidity, the material the building is made of, the BTUs of the appliance, how long it runs for, how long it is turned off, etc. I would imagine under certain circumstances, it would be more cost effective to turn the heat off, especially if it is for an extended period of time. Keep in mind though, that it does require more energy to heat something than it does to maintain a temperature for a constant time and external temperature. --Russoc4 (talk) 23:56, 19 June 2008 (UTC)

Kid, I cannot believe that you are a science major. For whatever length of off time, turning off the heater or air conditioner surely saves energy (or at least to cost exactly the same amount of energy if the off time is only seconds).

Let's say that you have a glass of water and you want to keep it between 67-73 F in a constant 30 F environment. The heater turns itself on at 67 F and turns itself off at 73 F. It only has one most-efficient burner setting. It produces y units of heat per second.

Let's say the 40 F heat gradient transfers x unit of energy to the cold air per second. x is the average energy output required by the heater. x must be small than y. Let's say y = 2x, your heater must be on 50% of the time.

Now if we leave the water to cool down naturally to 40 F by turning off the heater, the heat transfer shall be less than x during the cool down period. To bring it back to the 67-73 range, your heater shall do less work than keeping it within the range all the time.

Unless you have a heater with an afterburner-like part that heats up the room in no time (very inefficient to operate), a fixed-output burner shall always be no less efficient to operate if you turn it down manually from time to time.

A weight lifter may hold a 200 lbs thing in the air for an hour. It shall cost the poor guy much less energy if he puts it down for a while and then picks it up for a while.

If your NUCLEAR-POWERED heater could heat up your frozen house within one millisecond; then it may be very inefficient to let you house cool down because the extremely high output may be highly inefficient.

Otherwise, jut turn it off. Got it? Your factors are all BS. -- Toytoy (talk) 02:02, 20 June 2008 (UTC)

With all due respect, bull-roar. Equation please? Franamax (talk) 00:06, 20 June 2008 (UTC)

This very issue caused a friend of mine and his housemate to go their separate ways. A good argument is that thermal loss through exterior walls and windows is proportional to the temperature difference, so the less the difference, for the longest time, the less thermal loss, which means the less that has to be made up by the furnace or A/C. If they still don't see it, use the extreme argument: "What if you only heated the house once a year, would you still say it would cost less to keep it heated year-round instead ?". A common counter-argument is that "like cars, furnaces operate best at a constant rate rather than changing speeds all the time". This isn't the case because furnaces only have one "speed", unlike gasoline engines. StuRat (talk) 01:05, 20 June 2008 (UTC)

All I can say is: "THEY ARE NUTS!"

• http://www.boilerjuice.com/blog/11/Your-top-tips-for-saving-heating-oil.html

It works by monitoring how the room cools down at night, and from this can calulate the outside temperature (including wind chill factors).

Wind chill factor has very little to do with your house. Strong wind would surely cold down your house much faster, but wind chill factor is the temperature perceived by your skin which is subjected to water vaporization and many other living thing-only factors. How easily they are fooled.

I cannot work out a nice and easy way to explain the obvious. Maybe they should experiment with it and see their own heating bills. Many brain-dead and uneducated people in the U.S. leave their air conditioners on all the time. Maybe they should also leave their car engines running 24/7/365 because IT SAVES ENERGY NOT TO TURN THEM OFF. -- Toytoy (talk) 01:17, 20 June 2008 (UTC)

On the other hand, many people choose to install a cheapo brain-dead crappy controller that turns on and off all the time. Say they set the temperature at 70 F for both heating and cooling. It would save them much money if they put on some clothing during winter and set it to 60 F and set it to 80 F during summer.

One problem with many household central controllers is they only have one sensor in the living room. A more efficient design shall close the living room vent at night and only heat up the bed rooms. Saving a few lousy bucks up front seems to be the natural instinct to some less sophisticated souls. -- Toytoy (talk) 01:28, 20 June 2008 (UTC)

"

Toytoy. I said "it does require more energy to heat something than it does to maintain a temperature for a constant time and external temperature." Did you overlook the fact that in both circumstances, heat is also being lost. Assume heat is lost at the same rate, through windows or walls or whatever, if the temperature is to be constant, the heat going in will have to be equal to the heat going out. If, however, you are trying to raise the temperature, you will need to put in as much heat as is being lost, and then some to actually raise the temperature. (Do I smell a differential equation here?) And please do not disrespect me, or any other Wikipedians for that matter. Disagreeing with our answers is one thing, but don't bash us because you don't think we know what we are talking about. --Russoc4 (talk) 03:04, 20 June 2008 (UTC)

Actually Russ, it was me who said you were full of crap, so give Toytoy a break. Keep in mind here that we're talking about heating a house. You've basically said that it's better to keep the house warm all the time, rather than let it cool down. I asked you for some equations to support that, anything coming up soon? You mention a differential equation above, yet you're neglecting the basic fact of exponents - a house at 20 degrees above its' surrounding temperature radiates much less than half the heat of a house 40 degrees above. I could of course be wrong - please put up the math to prove me so, I'm always willing to learn! Franamax (talk) 04:37, 20 June 2008 (UTC)

Yes, as I said previously, the heat loss is proportional to the difference in the temps, so a cooler house will lose less heat. Russoc4, more energy will be used per minute while heating up the cold house, yes, but that's for a much shorter period of time than if the heat is run all day long. In the end, it works out to require more total energy to keep it warm all day. Franamax, while I agree with your technical analysis, I don't agree with saying somebody is "full of crap". When we disagree we should prove our POV without resorting to insults. StuRat (talk) 04:47, 20 June 2008 (UTC)

Stu, you're absolutely right. I was not actually telling Russ they were full of crap. You'll need to scroll way up there, what I was referring to was where I said "With all due respect, bull-roar" and I wanted to draw attention to myself as the original questioner of the premise, not Toytoy. I was the one who initially questioned the reasoning, I'll take the heat. I certainly don't want to question the motives of anyone who asks or answers here. I do, however, like to learn whatever truth is available. Apologies if any offence was taken from my wording. Franamax (talk) 05:26, 20 June 2008 (UTC)

I think the argument suggested above is a good one. Take the idea to its logical conclusion, and conclude that since it takes less "energy" to keep a warm thing warm than to make a cold thing warm, it would take less energy to keep the house warm all year round than to leave the heating off for the year and only turn it on for Christmas Day. Assuming they agree that this is nonsense, ask them why they think there is a point (length of time) where the optimal choice swaps from being "turn it off" to "leave it on", and ask them where they think that point is. Maelin (Talk | Contribs) 04:53, 20 June 2008 (UTC)

Russoc4, you need to learn something about equilibrium before trying to solve this problem. It takes more energy to heat up a cold thing, right? But to keep the warm thing warm, you spend energy to warm it EVERY SINGLE MINUTE. Do I need to show you how confused you are?

You have a 1000 gal tank made of some lousy thin and porous material. You use it to store water. Inside the tank, the water level is 10 ft, outside it is 0 ft. Water seeps out your tank from everywhere on its surface. The higher the water level, the quicker it leaks.

Now you use a pump to keep the water level at 10 ft (THE FIRST 10 FT). At this level, you lose 10 gal per minute. You need to pump in 10 gal/min to keep the water lever constant.

To make the calculation easier, let's assume water loss is directly proportional to the water level; that means 3 gal/min at 3 ft. (This assumption actually makes water loss at 3 ft too high.)

Now you turn off the pump and let the water level gradually fall to 0 ft. Your tank is empty now. The porous material is also dried up (assume the material does not absorb and hold water).

Let's say your pump can do 20 gal/min. No more and no less. You can either turn it on or turn it off. You cannot let it run at 50% speed. THIS IS SIMILAR TO MOST HOME HEATERS. They are either on or off. If hey are adjustable, the range generally falls within a range of maximum efficiency.

• Time to fill up = 1000 gal / (Water In - Water loss).
• Water loss = A function related to the water level which I am too sleepy to do.

It takes time for the pump to fill up your 10 ft tall tank (THE SECOND 10 FT).

Since the average loss of water per minute between the first 10 ft (before turn-off) and the second 10 ft (after restart) shall be lower than 10 gal/min (water level is lower), EACH MINUTE YOUR TANK IS BELOW 10 FT, IT LOSES LESS THAN 10 GAL/MIN.

Let's say you have two tanks side by side, one (always on) is losing 10 gal/min, and the other (turned-off for a period of time) loses less than 10 gal/min during its low water level time (draining time + empty time + fill up time), WHICH ONE IS LESS COSTLY? WHICH ONE USES LESS ENERGY?

You really need to brush up your basic idea about physics. I am harsh. Yet, I am also telling you the truth. You idea is fuzzy and unorganized. -- Toytoy (talk) 05:04, 20 June 2008 (UTC)

I'm not sure why, but I still think it is possible for there to be a situation where turning the heat off will prevail, while another would have keeping it constant would prevail. I'm basing this on the assumption that the rate of heat transfer is independent of the temperature differences. I don't have the time just now, but if I can think of a situation with some parameters, I'll be sure to post it as soon as I do. --Russoc4 (talk) 13:28, 20 June 2008 (UTC)

I, and apparently everyone else here, stills disagress. However, I should mention there are some valid reasons for keeping the temp in your house constant. A constant temp and humidity is easier on wooden furniture and your pets. Letting your house cool down too much could result in pipes freezing. It's also nice to not have to wait for your house to become comfortable when you get home (although a digital thermostat may allow you to fix that last issue). I can even find an energy conservation reason for you: If you don't have a digital thermostat, or can't use it because you come home at random times, then you can get all hot and sweaty when you first arrive home. If this results in you having to take more showers and wash your clothes more often, this could possibly require more energy than is spent keeping the house at a constant temp. StuRat (talk) 13:49, 20 June 2008 (UTC)

I don't see a reason to argue about it. I just bought a digital thermostat (a big whopping $12) and set it to be 50 during the day, turn to 72 10 minutes before I get home, turn to 65 while I'm asleep, heat to 75 10 minutes before I wake up (I like it extra warm when I wake up). Previously, I had it set on 70 all the time. My electricity bill went down (a lot more than the $12 I spent on the thermostat). Now, I'm experimenting with the AC, letting it warm during the day and when I sleep. -- kainaw™ 14:17, 20 June 2008 (UTC)

One thing I think people are way overlooking is that if you leave your AC/heater off, there will be a point where the temperature will stop changing any significant amount. People seem to assume that leaving it off all year means the temperature will drop constantly, and never stop dropping, so then the cost of heating it on Christmas day would be equal to maintaining, but obviously that's not true. I'm sure there are cases where it's better to leave it on than off (such as 5-30 seconds or so for lightbulbs, I forgot the exact time), and times where it's better to keep it off (like if you go out on vacation for a week, your heater will have to heat from 50F up to 70F or something one day instead of maintaining 70F all week. If your house drops 10F every day during that week, then yes, it'd probably cost the same amount either way, but your house won't decrease in temperature forever, so then turning it off would be better. I'm thinking that it's probably more energy efficient to turn it off if the time is long enough for the house to cool down to a point where the temperature won't drop any more for a significant amount of time, and more efficient to leave it on if not. Something along those lines. I'll try and work it out based on heat conduction equations and specific heat equations when I get home, if no one has. --Wirbelwindヴィルヴェルヴィント (talk) 16:13, 20 June 2008 (UTC)

There is a benefit well before the temp drops to match the outside temp. As I've said repeatedly now the temperature loss is PROPORTIONAL TO THE DIFFERENCE in temps between the inside and outside. That means that even a one degree drop in the inside temp will slow the rate of thermal loss. Also, unlike the case of the light bulb, where it stays on if left on, and thus avoids the damage caused by many transitions, heat left on will still cycle on and off, unless it's so cold outside that it stays on constantly. The furnace will actually go on and off more often if left on than if it's turned off when the home is vacant. StuRat (talk) 16:58, 20 June 2008 (UTC)

I don't mean matching the outside temperature. For my parents' house, from what I noticed, is that it never seems to get colder than a certain temperature (between 55 and 60, I think) even if the heater is left off for a week in the winter when it's 32 out, or something. Sure, heat still escapes, but not fast enough to matter as much. --Wirbelwindヴィルヴェルヴィント (talk) 17:10, 20 June 2008 (UTC)

That's because of heat coming up from the ground and also heat generated inside the house, by lights, electrical equipment, stoves, ovens, water heaters, people and pets. StuRat (talk) 17:22, 20 June 2008 (UTC)

@sturat: "Temp loss is proportional to the difference in temps". Do you mean the total loss of heat or the rate of heat loss. Obviously more heat is lost going from 70 to 50 than 60 to 50, but what about the rate at which it happens. Assuming outside temperature is constant, should the rate of heat transfer be nearly the same for both processes? --Russoc4 (talk) 23:26, 20 June 2008 (UTC)

I mean the rate of heat loss. In your example, the heat would be lost twice as quickly with the 20 degree diff as the 10 degree diff. So, when the temp dropped from 70 to 68 in the first case, it would drop from 60 to 59 in the second case. This is why you save money by setting the thermostat lower, you have less energy loss as a result. StuRat (talk) 05:31, 21 June 2008 (UTC)

Thank you for replies. I like the example of only heating the house one day a year, although the counter-arguement will be that there is some shorter time-period where it makes sense to leave the heating on. An analogy that has occurred to me is that of a leaky bath with a running tap. Water is leaking out of this bath (heat loss) while at the same time water is slowly running into it from a tap (you might use a different word in American-english) just enough to keep it full. You want the bath to be full when you get home from work - will you save water by letting the tap run all the time, or by turning the tap off in the morning and putting the tap full on to fill the bath in the evening? Thanks 80.0.108.8 (talk) 12:16, 21 June 2008 (UTC)

An event more succint arguement may be that because most of the water (heat) that you put in during the day will leak out of the bath (house) during that time, you will therefore always use less water (heat) to fill up the bath (house) just before you come home from work, than you would use by letting it run all day. 80.0.110.56 (talk) 14:40, 22 June 2008 (UTC)

Last surviving human artefacts?

If humans were all suddenly wiped out, what would be the last recognisable human artefact to survive millions or billions of years into the future, rather than becoming dust? Manhole covers? 80.0.101.122 (talk) 23:50, 19 June 2008 (UTC)

Voyager 2. If you look closer to home, whatever we left on the moon will also survive quite a while. On the Earth's surface, erosion, corrosion and subduction will remove/recycle most artifacts sooner or later. --Stephan Schulz (talk) 23:54, 19 June 2008 (UTC)

Noble metals? --Russoc4 (talk) 23:59, 19 June 2008 (UTC)

(ec) And eventually the death of the sun will trash anything on Earth or Moon, plus any surviving satellites and such, while there's no particular reason Voyager and the other interstellar probes shouldn't last much longer. Algebraist 00:01, 20 June 2008 (UTC)

Unless, of course we go out there to retrieve them all for display at the Smithsonian Institute in a hundred years or so... :) --Kurt Shaped Box (talk) 01:35, 20 June 2008 (UTC)

(e/c) I'll vote for Voyager (which was just said on the TV as I typed it!) but, without having done the math, I'd also propose isotopes of plutonium. Franamax (talk) 00:03, 20 June 2008 (UTC)

Wasn't this question just asked the other day? Someone provided a link to an article here about a book that was written on this same subject. I recall the article saying something about forests taking over cities and Mt. Rushmore being one of the last bits of evidence to disappear. Dismas|^(talk) 00:07, 20 June 2008 (UTC)

Found it. The World Without Us. Dismas|^(talk) 00:09, 20 June 2008 (UTC)

Enriched uranium will stick around much longer than plutonium, and since the isotope ratio of natural uranium is so predictable, any deposits of enriched uranium will be obvious for many half-lives of U-235. --Carnildo (talk) 21:22, 20 June 2008 (UTC)

(after ec) According to the documentary Life After People, which was shown here the other week, the last remaining 'large' human creations on earth would be the Pyramids, The Great Wall of China, the Hoover Dam and Mount Rushmore. I also remember reading a New Scientist article years ago which mentioned that when humanity comes to an end, the last remaining artificial evidence of our existence may well be glass bottles, or fragments thereof. --Kurt Shaped Box (talk) 00:11, 20 June 2008 (UTC)

I dunno about the Pyramids, aren't they on a northeast floating plate? At 2 cm/yr, I'm thinking it's only 30-40 million years 'til they go under. Franamax (talk) 00:23, 20 June 2008 (UTC)

Hmmm. I wonder if the Pyramids would still be recognizable as Pyramids at that point in time? --Kurt Shaped Box (talk) 00:37, 20 June 2008 (UTC)

(EC) I believe we're talking about timescales of less than 1 million years where they will disintegrate due to erosion and biological action. -RunningOnBrains 00:38, 20 June 2008 (UTC)

Well, if we're talking about just a million years, I'll re-nominate nuclear waste as our most enduring legacy. However I do believe that the Pyramids will still be somewhat pointy-shaped at that time. Franamax (talk) 03:59, 20 June 2008 (UTC)

Obviously television broadcasts of Star Trek: The Motion Picture have gotten farther than Voyager, but will they last longer? Will attenuation by interstellar dust wipe them out before V'ger gets pinged to death by micrometeorites or runs into a star? --Sean 04:20, 20 June 2008 (UTC)

For starters, the recent discussion on signal fade may be useful. Jdrewitt (talk) 06:34, 20 June 2008 (UTC)

According to the book The World Without Us and the Scientific American article about it, broadcasts and radio signals produced by humans may "survive" and travel through space for trillions of years (that is if the universe survives for trillions of years). --Apollonius 1236 (talk) 02:48, 21 June 2008 (UTC)